Human Variation and Race

Solar radiation is an environmental stress that, in high levels, has had a major impact on the evolution of hominid specie. Extreme solar radiation was a major problem to our predecessors in sub-Saharan Africa, as their skin tone, previously covered by hair or fur, was exposed to the intense rays of the sun. Darker skin tone, which is determined by the levels of melanin present in their cells, helps to absorb the harmful UV rays. UV rays, if not protected against, can cause genetic mutations to skin cells which can lead to cancer and eventually, death. Additionally, folate, a B vitamin essential to cell division in embryonic fetal development, is degraded by UV radiation leading to leading to less reproductive success if affected.

A short term adaptation to solar radiation does not really exist, as our bodies cannot adjust on the fly

to exposure. This is why fair-skinned people burn easily, and are more susceptible to skin cancer.

An example of a facultative adaptation would be how the skin tans, and produces more melanin to protect against over-absorption of UV rays, as h. sapiens migrated away from the tropics out of the intense UV radiation areas, the dark pigmentation gradually lightened as the need for high levels of melanin and UV protection diminished. 

As generation after generation of hominids adapted to living at higher altitudes and further north or south of the equator, they were exposed to less intense UV radiation. As a result, they developed a deficiency of vitamin D. A developmental adaptation was that the reduction in the production of melanin allowed for more efficient absorption of Vitamin D, a building block for bone mass and density, through the skin. This also allows the body to be able to convert Vitamin D to 1,25D, a crucial molecule needed for the prevention of m. tuberculosis and other diseases. An attribute associated with this adaptation with some frequency, which was evidenced as early as  h. neaderthalis, is red hair and freckles. 

Cultural adaptations to solar radiation can be observed around us in our everyday lives. Fair skinned people use sunscreen lotion to form a barrier between their skin and harmful UV rays, along with hats and umbrellas. As many humans work in offices for a large part of their day, the need for Vitamin D supplements will continue to increase. Many nutritional products are fortified with Vitamin D to help meet the recommended daily intake.

The more the scientific community studies genetic adaptations to solar radiation, the better off society will be. If we understand how and why our skin tones are different from our neighbors, we will not see skin tone as a point of differentiation, but, rather, as an indication of equality on our evolutionary tracts. Additionally, the this research can be used for the betterment of society, as new and more advanced treatments and protections against solar radiation can be developed and administered.

If we try to use race to help us understand human variation, we fail miserably. There is no difference at the DNA level between what society refers to as ‘race’, other than variation in phenotypic expression.  Rather, studying the environmental pressures that led to the great variation we observe today helps us to understand where our ancestors came from, what led to their migratory path, and possibly a glimpse into how our descendants will evolve and adapt to their own pressures.

Symbolic Language Experiment

Part 1:

Carrying on a conversation without the use of symbolic language is more difficult than it would seem. At first, it was a novelty, trying to figure out the most effective way to communicate without violating the rules. The conversations were difficult to maintain, as I could not fully articulate my side, leaving the other party laboring to keep the discussion from dying.

The first attempt at this experiment was frustrating for my partner. She grew weary of trying to translate and interpret my movements as I attempted to answer questions and respond to her queries. She adapted to my communication limitations and began using hand signals and motioning in conjunction with her speech, which demonstrated a willingness to be flexible in order to be understood. The control of the conversation undoubtedly belonged to my partner. A new topic or subject only came from my partner, and therefore, the power was firmly in her grasp. She would ask questions, and being limited in my ability to communicate, I was subjected to primitive answers without truly being able to express much more than yes or no.

Imagining that we each represented different cultures, those with the ability to use spoken or symbolic language would definitely have the advantage over those that cannot express complex ideas. The ability to articulate exactly what one intends to communicate is a clear point of differentiation. There was an air of superiority coming from my partner in the conversation, and a feeling that she could take the discussion in whatever direction she wanted. I surmise that the environmental pressures that led our hominid ancestors to adapt to communicate verbally would naturally create a separation from those that did not undergo the same or similar adaptation, leading to the extinction of the latter. I think, perhaps, the inequality in access to education in our country could be seen as a reflection of this dynamic. Those who have had the privilege of receiving a higher education oftentimes look down on those who have not had the same experience.  This clearly defined line of separation can lead to animosity and distrust between the two groups, furthering the aforementioned separation.

Part 2:

The experiment that prohibited the use of body language, inflection, and facial expressions was not as difficult as the previous exercise which limited symbolic speech. The value of being able to vocalize, I believe, is far more valuable, even if it cannot be accompanied by expressions and body language. While there was some difficulty in deciphering my intentions and emotions associated with my words, my opinion was understood by my conversation partner.

The importance of the use of signs in our communications cannot be overstated. In a given conversation, the body language, inflection, intonation, expressions, and gestures all play a role in how our words are both delivered and received. Crossed arms, a furrowed brow, short/harsh answers, and quick responses can all be interpreted in a negative way, and provide more context to the words that are being spoken. Conversely, a smile, a raised brow, and an occasional nod could be indications that our words are being understood and received positively.

The ability to observe and understand non-verbal communication such as facial expressions and body language are a very important adaptive trait. Understanding intention and being able to identify deception would have been major factors in the survival of our early hominid forebears, and still play a major role in the success of our species. If a rival or competing group offered to share its resources, one could observe body language and expressions of not only the speaker, but also of the bystanders to better inform his opinion and decision, potentially avoiding a trap or ambush.

Reading body language is not inherent in everyone. Individuals with Autism often have trouble recognizing emotion, and they tend to focus on the words being spoken rather than the manner in which they are delivered. I think that this genetic mutation would pose problems to members of a more primitive society, where this trait would be seen as a weakness that should be exploited. Body language can also be unreliable. Pick pockets, illusionists, and magicians have been using sleight of hand and intentional misdirection through body language for as long as they have been around. Ignoring the body language and focusing on the verbal communication is useful in avoiding deception.

Lessons from Piltdown

   Between 1911 and 1912, an amateur archaeologist named Charles Dawson unearthed an apparent transitional fossil that seemed to fill in a gap in the fossil record. Dawson called upon Arthur Smith Woodward, of the British Museum, as well as Pierre Tielhard de Chardin and Arthur Keith, all respected scientists, to assist in validating his claim and further excavating the Piltdown site. What was found was a portion of the skull, along with a portion of the lower right jawbone with two teeth still attached. Initially, the fragments were determined to be from the same specimen, and claimed to date to between 500,000 and 1 million years old. The reconstruction and examination of the remains revealed the primitive hominid to have a big brain and the mandible structure of an ape. This was touted as a groundbreaking discovery, as this would be the earliest human-like ancestor that had been discovered.

The discovery of the Piltdown Man was met with jubilation from the British scientific community, as the specimen was found in British soil, which stoked national pride. One of the first scientists that Dawson called in to assist, Arthur Keith, was particularly interested in the discovery because it seemed to validate his long held theory that humans evolved to develop larger brains before they adapted to upright walking. The artifacts found at Piltdown were not, however, made available to the scientific community at large, and therefore, were not thoroughly examined and verified.

Doubt of the authenticity of the Piltdown Man initially arose in 1925, when Raymond Dart found a skull in South Africa that would have had a much smaller brain, but the jaw formation of a human. This was inconsistent with the discovery at Piltdown, and cast doubt on the discoveries of both Dawson and Dart. In roughly 1939, a new method was developed for testing and determining age, called flourine dating. The method measures the amount of flourine and other elements that have been absorbed by objects within a strata, and, when compared to other things found within the strata, the approximate age can be determined. In 1949, the Natural History Museum performed these tests on the artifacts from Piltdown, and determined that the skull fragment and jawbone were actually closer to 50,000 years old, not nearly old enough to be a hominid ancestor. Then, in 1953, the fossils underwent full analysis and inspection, revealing that the teeth had been ground down with a metal implement to make them resemble human teeth. Furthermore, using more advanced flourine dating, the skull was determined to be a different age than the jawbone and teeth, which were now believed to simply be old bones, not fossils at all. To top it off, the specimens had been treated with chemicals and paint to mimic the aging of fossils.

The fraud and hoax were revealed to the world in November of 1953, raising many questions about the identity of the perpetrators of the hoax as well as questions about the reliability of the scientific community. Initially, suspicion landed on Dawson and Keith. Dawson, because evidence came to light that he had aspirations of making a great discovery and gaining notoriety, leading him to falsify multiple scientific claims in his lifetime. Arthur Keith was suspected of involvement because the finding seemed to validate his theory of the evolutionary timeline and development process in regards to hominids. In the years since, carbon-14 dating and DNA analysis have revealed the bones to be from different modern species altogether, a human and a chimpanzee. In the mid-1990's, a trunk was found in the storage of the British Museum which contained bone fragments and pieces that had the same chemical treatment applied as had the items found at Piltdown. This trunk belonged to Martin Hinton, a volunteer who worked for Arthur Smith Woodward, and who was disgruntled at the time.

The fact that motive for creating this hoax can be provided for each of these three men, shows that despite the checks and balances and verification inherent in the scientific method, human nature and self-serving can not be overlooked as factors when weighing evidence. This flaw in humans cannot be eradicated, and therefore, must be considered in the course of verification and validation. Human knowledge and understanding is the driving force behind scientific exploration and the quest to fill in the blanks in our history, and the human elements of pride and greed will always be a factor. The lesson to be found in this unfortunate portion of history is that we must always examine information presented to us from a scientific perspective as well as from a human perspective. We must be vigilant in our insistence upon following the scientific method using the most up-to-date technology at our disposal, but perhaps more importantly, we must be willing to admit when we are wrong.

Primate Dentition Comparison

Safika

   Safika are arboreal (tree-dwellers) indigenous to Madagascar and the Comoro Islands. They inhabit varied terrain including the desert, as well as dry, evergreen, and rainforests. Safika typically dwell in the upper canopy of the forests, away from most predators, though raptors and fossa (a weasel like rodent) have been identified as predators. Resources are plentiful, without fierce competition for food supply. Safika present a dental formula of 2.1.3.3, though the morphology is a bit unique. They have what is known as tooth-comb structure, wherein the incisors and canines protrude at an angle to form a comb-like grooming feature. Additionally, the first premolars are shaped like typical canines, having a conical high crown for tearing and puncturing, along with shearing crests on the molars to aid in tearing through plant matter and cracking seeds for nutrients. The safika's diet is made up of seeds, leaves, flowers, and fruit.


Spider Monkey
   Spider Monkeys are native to South and Central America, and have been found as far north as Mexico. They inhabit the warm and humid rainforests, are arboreal, and are not typically threatened by predators. Spider Monkeys exhibit the dental formula of 2.1.3.3 or 2.1.3.2, with high crowned incisors for picking fruit and tearing into the flesh and rounded molars used for grinding bark and other plant materials. The spider monkey diet consist of fleshy fruit, leaves, bark and wood, honey, the occasional insects/larvae and birds eggs.






Olive Baboon

  Olive baboons are semi-terrestrial, inhabitants of over 21 African countries. Olive Baboons forage on the ground during the day for whatever food source they can find, and then retreat to the trees or cliffs to avoid the many predators in their environment, which include chimpanzees, crocodiles, African wild dogs, lions, and leopards. The dental formula of Olive Baboons is 2.1.2.3, the same as all Old World Monkeys, Apes, and Humans. Olive baboons have seemingly unnecessarily sharp and pointed incisors and canines, but these help to kill and tear flesh from it's mammalian prey as well as act as a defense mechanism against it's own predators. They are omnivores, and never turn down a good meal, whether it is comprised of grass, seeds, leaves, fruit, tubers, small mammals or young birds.


Lars Gibbon
   The Lars Gibbon is an arboreal species native to Southeast Asian rain forests, with lush vegetation and ample supply of food sources. They dwell high in the trees, and are not subject to much natural predation. As a lesser ape, Lars Gibbons have a dental formula of 2.1.2.3, with bunodont, or round-cusped molars. The upper molars are abnormally large, and exhibit a cingulum, which helps with he grinding function. The canines are prominent and conical. The food sources available to Lars Gibbons is fruit, leaves, bark, flowers, plant shoots, eggs, small birds, tree frogs, and insects.


Chimpanzee
   Chimpanzees reside in Africa along rivers which provide dense vegetation and varied plant life. They require a steady supply of water, and a wide variety of fruits, seeds, and other plants. Chimpanzees exhibit a dental formula of 2.1.2.3, and have the most similar dental morphology to humans. As omnivores, they eat fruit, seeds, nuts, insects, and the meat of medium sized mammals including smaller monkeys and apes.
 

Ecological factors play an instrumental role in the evolution of primates, as we have noticed in the varied morphology of the dentitions exhibited by these 5 species.

Analogy v. Homology

Homology:

Seals and humans are both mammals that have the shared homologous trait of the bone structure of the arm and hand(flipper). In humans, the skeletal structure is covered with flesh, muscle and skin, and has fine mobility and flexibility to perform different functions, including gripping and squeezing. The ability to move each digit independently is a point of differentiation, and an advantage over most other animals. In seals, the framework is covered with fat/blubber, thick skin with fur for warmth, and the area between the bones is webbed so that the seal is an efficient swimmer. The common ancestor would be an early reptile that developed a similar structure as it was pressured to be able to traverse diverse terrain in order to survive and reproduce.  

Analogy:

Seals and ducks are two different species that spend a large portion of their time in the water, though one is a mammal, and one is a bird. They have the analogous trait of webbing on their foot/flipper. The seal has large hand like appendages with furry webbing between the joints which help the seal move about in easily in the water. Ducks, on the other hand, have a thick, adapted, skin-like webbing over the skeletal structure and they move very rapidly underwater to propel the duck, which sits atop the water. We know that this trait is analogous because it is not a character that the common ancestor exhibited, but rather, this trait would have evolved in each species as a response to similar ecological pressures to adapt to a life spent largely in the water

Protein Synthesis

TGCGTACCAAGGGAACGTAACACAAGGCAAGTTGTCTATCATTG

Charles Darwin's historical influences

Charles Lyell, a British lawyer, geologist, and contemporary of Charles Darwin, established the geological theory that came to be known as uniformitarianism. Lyell's view was that the changes observed in the geological and fossil record were directly related to the gradual, yet uniform changes that the earth experiences. This view was revolutionary because, at the time, the popular theory was that the geological variance that was being observed had occurred as the result of catastrophic events that drastically shifted the earth and effected the ecology.

The work of Lyell had a lasting and profound impact on how Darwin, and subsequently, the scientific community as a whole, understand the history of the earth, and therefore, life. Acceptance of the idea of uniformitarianism is essential to understanding the environmental changes that were occurring, creating both the opportunity and the necessity for adaptation of traits for survival. This theory proved to be the groundwork and key to explaining the process of natural selection, as well as influencing the view of time as immensely more vast than previously believed. These views undoubtedly played a major part in the development of Darwin's theory of natural selection, and I do not believe his hypothesis could be supported without the acceptance of the vastness of time, or the ever-changing environment.

The scientific community in England during much of the 19th century was tied closely to the church, and therefore, any theory was scrutinized through the lens of biblical teaching. That being the case, Darwin's assertion that organisms have changed and adapted over time, spawning new species, was not widely or readily accepted. The was strong response from his family and friends that his theory was contrary to the religious belief of the day, which caused Darwin to delay publication until he was pressured by the release of a paper by his colleague, Alfred Russel Wallace. The main point of concern was that the naturalists held that the species were ordered and unchanging, as they had been originally created by God.





Source:
http://evolution.berkeley.edu/evolibrary/article/0_0_0/history_12

Desert Island Dreaming

So, I'm stranded on this desert island, and I can only bring two things with me. How could I narrow it down to two things?!

I need to be able to make fire, but people have been making fire for thousands of years, so I think I can handle it. I need a knife, but I can sharpen a piece of wood or a stone to make a knife, so I'm not wasting one of my two items on that. I need water, but on an island, I can figure out how to filter water so I can drink it. I need a steady source of protein, and I'm not the best fisherman(on top of not digging seafood), so I'll definitely need something to fulfill this need. I'm a huge music junkie, so I should bring an iPod, right? There is no way to recharge it after it's dead, so me singing The Cure will have to do (no one else is listening anyhow).

Alright, I'm bringing a pregnant pig and a cast iron skillet. The pregnant pig, because I'm going to need to eat relatively soon, and there are pretty good odds that the offspring will be able to reproduce quickly enough for me to have an abundant supply of pork. The cast iron skillet, because, well, it's the most versatile piece of cookware, and I'm going to be up to my ears in pork.